Appendix 1: mtLSU gene sequences

 

 

                           10        20        30        40        50

60        70        80        90        100       110       120

                           .         .         .         .         .

.         .         .         .         .         .         .

 

P.c.muris

GGTTTTCTGCGAAATCTATTTTAGTAGATGATTTAT???????d************************************

****************TATTTTAT?d**********TAd*G

P.c.carinii

......................G........C..G.d??????i....................................

...............TAT.A..TG?................

P.c.griseus

...............T.G......CGA.GAG..C..???????.....................................

.................T.A....?.............iC.

P.c.macaco

...............T.G......CGA.GAG.....???????.....................................

.................T.A....?................

P.c.midas

..............GT.G......C.A.ATG.....d??????i....................................

...............TA..AA...?................

P.c.imperator

..............GT.G......C.A.ATG.....d??????i....................................

...............TA..AA...?................

P.c.oedipus

..............GT.G......C.A.ATG.....d??????i....................................

...............TA..AA...?................

P.c.callimico

..............GT.G......C.A.ATG.....d??????i....................................

...............TA..AG...?................

P.c.fuscicollis

..............GT.G......C.A.ATG.....d??????i....................................

...............TA..AG...?................

P.c.callithrix

..............GT.G......C.A.ATG.....d??????i....................................

...............CAG.AA...?................

P.c.geoffroyi

..............GT.G......C.A.ATG.....d??????i....................................

...............CAG.AA...?................

P.c.pithecia

..............GT.G......C.A.ATG.....d??????i....................................

...............GGGAAC...?................

P.c.saimiri

..............CT.G......C.ATCTG....Ciid????i....................................

.............ACTCCCCA.C.?................

P.c.nigroviridis

..............AT.G....G.C.A..TG.....iiiidiiiTTTA.TTTCATTTGATATATATATTGATATAATATT

AATTATAAATTAAATGAT.C.ATAdi........AA.....

P.c.nictitans

..............AT.G....G.C.A..TG.....iiidd?iiTTTA.TTTCATTTGGTATA..TATTGATATAATATT

AATTAAAAATCAAATGAT.G.ATAdi........AA.....

P.c.hamlyni

..............AT.G....G.C.A..TG.....iiiiddiiTTTA.TTTCATTTGGTATA.ATATTGATATAATATT

AATTATAAATTAAATGAT.G.ATAdi........AA.....

P.c.nemestrina

..............AT.G....G.C.A..TG.....iiiidddiTTTT.TTTCATTCATTCAT.TCAAAGA.........

.............ATGA..G.ATAiiATAATAATAA.....

P.c.fascicularis

..............AT.G....G.C.A..TG.....iiiiiddiTTTTTTTTCATTCATTCAT.TCAAAGA.........

.............ATGA..G.ATAiiATAATAATAA.....

P.c.mulatta1

..............AT.G....G.C.A..TG.....d??????i....................................

...............GA..G.ATAdi........AA.....

P.c.mulatta2

..............AT.G....G.C.A..TG.....d??????i....................................

...............GA..G.ATAdi........AA.....

P.c.hominis

..............AT.G....G.C.A..TG.....id?????i....................................

..............TCCTC..A.Adi........AA.....

 

                          130       140       150       160       170

180       190       200       210       220       230       240

                          .         .         .         .         .

.         .         .         .         .         .         .

 

P.c.muris

TGGGTATAGCACTGAATATCiTGiiiiidii?TAA***************TTTGAATTACAAGAAGGGd**AGTAd*TGA

AiAGTACTTACTTTGGATATTTAATCTCAGAATAACTAATA

P.c.carinii

....................d**....d?d.?..................*C.T.TG.T**...................

..G...............................G...T..

P.c.griseus

.A.................T.AA.....i..d...CATAAT.......TTAC.T..G.TA.TA.....iGG....iA.A.

T..T......TC.CTA.................G.......

P.c.macaco

.A.................T.CC.....i..i...CTTAAGAGGTTAAAA.C.T..G.TAT.AG..........GiA.A.

...T......TC.C.A..G..............G........

P.c.midas

.A....................A..d???..?A**...............*****.G.TT..AG...........iT.AT

G.T...T...TC.C..G................G.......

P.c.imperator

.A....................A..d???..?A**...............*****.G.TT..AG...........iT.AT

G.T...T...TC.C..G................G.......

P.c.oedipus

.A...................AA..d???..?.**...............*****.G.TT..AG...........iT.AT

G.T.......TC.C..G................G.......

P.c.callimico

.A....................A..d???..?.**...............*****TA..T..AG...........iT.AC

G.T...T..TTC.C...................G.......

P.c.fuscicollis

.A....................A..d???..?.**...............*****TA..T..AG...........iT.AC

G.T...T..TTC.C..G................G.......

P.c.callithrix

.A.................T......d??..?.**...............****....TT..AG...........iT..C

G.T.......TC.C..G................G...G...

P.c.geoffroyi

.A.................T......d??..?.**...............****....TT..AG...........iT..C

G.T.......TC.C..G................G...G...

P.c.pithecia

.A...................AA.d????..?A**...............**********G.AG................

G..A......TC.C...................G.......

P.c.saimiri

.C...............C....Cd??????.?.**...............*************GT......T..TiC.TC

Gd*A.C..CC..AC.A..T..........A...G......C

P.c.nigroviridis

..................C...T???????d?***...............*************G...........iT..T

Td*A..T...TC.C..G............A........T.T

P.c.nictitans

................C.C...T???????d?***...............*************G...........iT..T

Td*A..T...TC.C..G....C.......A........T.T

P.c.hamlyni

................C.C...T???????d?***...............*************G...........iT.AT

Td*A..T...TC.C..G............A........T.T

P.c.nemestrina

..................CT..T???????d?***...............*************GG..........iT.AT

Td*A..T...TC.C..G............A........T.T

P.c.fascicularis

..................CT..T???????d?***...............*************GG..........iT.AT

Td*A..T...TC.C..G............A........T.T

P.c.mulatta1

..................CT..T???????d?***...............*************G...........iT..T

Td*A..T...TC.C.AG.G..........A........T.T

P.c.mulatta2

..................CT..T???????d?***...............*************G...........iT..T

Td*A..T...TC.C.AG.G..........A........T.T

P.c.hominis

.A....................C???????d?***...............*************G................

...A..T...TC.CA..............A........T.T

 

                         250       260       270       280       290

300       310       320

                         .         .         .         .         .

.         .         .

 

P.c.muris

AGiiiAAGATAAGATAAATTCTCAGACTTTTTGCGATAAGGTGAAAAGTCGAAAGGGAAACAGCCCAGAd*CAGTGAAGC

A

P.c.carinii

.Td.?.***..T...G.G..A........C..............GG......G...........................

.

P.c.griseus

..d.?.***......G.GC.TAAG..................AT......A..................iA....A..TA

.

P.c.macaco

..d.?.***.T......GC.TAAG.....A.A...........GT.....T..................iA....A..TA

.

P.c.midas

TTd.?.***GT.A......AA..G....A.............A..T....A..................iA...A.G.TA

.

P.c.imperator

TTd.?.***GT.A......AA..G....A.............A..T....A..................iA...A.G.TA

.

P.c.oedipus

TTd.?.***GT.A......AA..G....A.............AG.T....A..................iA...G.G.TA

.

P.c.callimico

TTd.?.***...A..G...AA..G....A.............AG.T....A......G...........iA.....GTTA

.

P.c.fuscicollis

TTd.?.***...A..G...AA..G....A.............AG.T....A......G...........iA.....G.TA

.

P.c.callithrix

TTd.?G***A.........GA..G....AC............AGGT....A......G...........iA...A.G.TA

.

P.c.geoffroyi

TTd.?G***A.........GA..G....AC............AGGT....A......G...........iA...A.G.TA

.

P.c.pithecia

T.d.?G***GG.A.....CAA..G....AC......G.....AGGT....A..................iA......T.A

.

P.c.saimiri

TTd.?T***CTGTG......G.......G.CG....G.....TG.T....A..................iA......TTA

.

P.c.nigroviridis

.T?d?****....G.....AA.......A.............AG.T....A...............T..iA....TTTTA

.

P.c.nictitans

.T?d?****....G..G..AA.......A.............AG.T....A...............T..iA....TTTTA

.

P.c.hamlyni

.T?d?****....G.....AA.......A.............AG.T....A...............T..iA....TTTTA

.

P.c.nemestrina

.T..dTT**AT..G.....AA.......A.............AG.T....A..................iA....T.TTA

.

P.c.fascicularis

.T..dTT**AT..G.....AA.......A.............AG.T....A................A.iA....T.TTA

.

P.c.mulatta1

.Td.?T***.T.TG.....AA.......A.............AG.T....A..................iA....T.TTA

.

P.c.mulatta2

.Td.?T***.T.TG.....AA.......A.............AG.T....A..................iA...GT.TTA

.

P.c.hominis

CT?d?****...A......AA.......A.G...........AG.T.......................iA.........

.

 

 

 

 

Appendix 2. DHPS gene

                          10        20        30        40        50

60        70        80        90        100       110       120

                          .         .         .         .         .

.         .         .         .         .         .         .

 

P.c.muris

AATTTATAAATGCAGGAGCAACAATAGTTGATATTGGTGGGCAGTCTACAAGACCAGGTTCGCATATTATACCTTTAGAA

GAAGAGATTTTTCGAGTTATTCCTGCTATAAAATATCTTC

P.c.midas

.T..............T.........A..........C..A...........G......G.C......G.TT.......G

..........C...............A............T

P.c.callimico

.C..............T..G......A..........C......C.....G..........C......G.TT.......G

..........C...............A............T

P.c.fuscicollis

.C..............T..G......A..........C......C.....G.G........C......G.TT.......G

..........C...............A............T

P.c.geoffroyi

.C..............T..G......A.............A...C.....G....T.....T.....CG.TT........

..........CC..............A......C.....T

P.c.aotus

.C.................G......A.C...........A...C.....G.G..T.....T......G.TT.......G

.....A....CC..............A............T

P.c.sciureus

.C...........T.....G......A.............?..AC.....G.G..T.....T.G...CG.TT.......G

.......C..CC..............G............T

P.c.nigroviridis

.T......G.C.....G.........A...................C...C.T..T..C..T......G.TT.......G

..........C...G.................G.......

P.c.hominis

.T..............G..G..G...A.......................C.G..T.....A...G..G.TT..A....G

..........C...........................CT

 

                          130       140       150       160

170       180       190       200       210       220       230       240

                          .         .         .         .         .

.         .         .         .         .         .         .

 

P.c.muris

TGAAAACATATCCTGATATTTTAATAAGTATAGATACATTTCGTTCTGAAGTTGCAGAACAGGCAGTTAAGGCTGGTGCC

AGTCTTGTTAATGATATAAGTGGTGGAAGGTATGATCCAA

P.c.midas

.A...GT................G.G........C..............G...........A...A...GA..A.....T

..C....................A................

P.c.callimico

.A...GT................G.G........C..............G...........A...A..GGA..A.....T

..C............G...CC..A............T...

P.c.fuscicollis

.A...GT................G.G........C..............G...........A...A..TTA..A.....T

..C............G...CC..A............T...

P.c.geoffroyi

.A...GT................G.G........C..............G...........A...A.C.GA..A.....T

..C....................A.....A.....C....

P.c.aotus

.A...GT................G.G..C.....C..........................A...A...GA..A.....T

..C...........??????????????????????????

P.c.sciureus

.A...GT................G.G..C.....C..............G...........A...A....A..A.....T

.....C.........G.G.....A.....A..........

P.c.nigroviridis

.A...GT................G....C........T.......................A...A...GA........T

...T.C.................A................

P.c.hominis

.A...GT................G.....G.......T...........G...........A...A.............T

.......................G................

 

                             250       260       270       280       290

300       310       320       330       340       350       360

                             .         .         .         .         .

.         .         .         .         .         .         .

 

P.c.muris

AAATGCTTAGTACTGTTGCTAGACTAAAGGTTCCAATATGTATAATGCATATGAGAGGCAATTTTTTAACTATGGACAAC

TTAACTGATTATGGTGTTGATATTATAGAACAAATTACTA

P.c.midas

.....T..GAG..G.........T.G..A................................CCC............T..T

...............AC..........A............

P.c.callimico

........GA.GTG.........T.G..A................................C..............T..T

...........................A.G..........

P.c.fuscicollis

........GA..TG.........T.G..A................................C..............T..T

...........................A............

P.c.geoffroyi

.....T..G...TG.........A.G..A................................C.C............T..T

...........................A............

P.c.aotus

????????????????????????????????????????????????????????????????????????????????

????????????????????????????????????????

P.c.sciureus

.....T..GA...A........GT.G..A................C.....CA.....T..C.C............T..T

..............C.?..........A............

P.c.nigroviridis

.....T.C.A.GTAA....A.A.T.G.GA.....................................C.............

......A........AC..........A...........G

P.c.hominis

.........A.GTG.....C.AGT.G..A.............................TG...................T

...............ACC.........A............

 

                             370       380       390       400       410

420       430       440       450       460       470       480

                             .         .         .         .         .

.         .         .         .         .         .         .

 

P.c.muris

TAGAATTAGAAGAACTACTTAATTCTGCTGAAAAGTCTGGCATTCCTCGTTGGAACATTATTTTAGATCCTGGATTAGGA

TTTTCTAAAACGTTTCATCAAAATATAGAATTATTAAGAA

P.c.midas

........C.....G.G...GT...............A..T......T.G.....T.................G......

...G.C.....T.CA.........................

P.c.callimico

C...G...C.G...T.GG...C............T..A...........G.....T.................GC.....

.....C.....T.CAT........................

P.c.fuscicollis

C...G...C.G...T.GG...C............T..A...........G.....T.................GC.....

.....C.....T.CAT........................

P.c.geoffroyi

C......GC.G...T.G....C............T..A..T........G.....T.................GC.....

.....C.....T..ATG.......................

P.c.aotus

????????????????????????????????????????????????????????????????????????????????

????????????????????????????????????????

P.c.sciureus

C...G...C.G.G.TCT....T............T.....T...T....G.....T........G........GC.....

...G.......TCCAT......G......G..........

P.c.nigroviridis

A....C...G......G....C..T........GT.....T........A.....T.................G......

..CG.......T.CCT.C........G.....G.......

P.c.hominis

A.............T.G...GT..T........GT..A..T...TT.A.G.....T.................G......

...G.......T.CCT................G.......

 

                             490       500       510       520       530

540       550       560       570       580       590       600

                             .         .         .         .         .

.         .         .         .         .         .         .

 

P.c.muris

GATTTAATGAATTAAAATCTAAAAATTGTTTTAACGGTCTTCCATGGTTGCTTGGTCCAAGTCGTAAAAGATTTACTGGT

TTTATTACTGGTGATAATATGCCAAAAGATAGAATTTGGG

P.c.midas

....C.G....C........C.GCG........GT...T.GG......................C...........A..C

.G.G....A.AC....T...............G.......

P.c.callimico

....C.G....C........C..C.........GT...T.GT.............C........C...........A..G

.G.G....A.A.....T...............G.......

P.c.fuscicollis

....C.G....C........C.GC.........GT...T.GT.............C........C...........A..G

.G.G....A.A.....T...............G.......

P.c.geoffroyi

....C.G....C........C.GCG........GT...T.GT.T................................A..C

.G.G....A.A.....T...............G.......

P.c.aotus

????????????????????????????????????????????????????????????????????????????????

????????????????????????????????????????

P.c.sciureus

....C.G.............C.GC.........GT...T.G..T....................C...........A..G

.G.G....A.......C...............G.......

P.c.nigroviridis

....C...........G...C..C.........GT...T.A..T...A.A..............C...........A..A

.A.G.....A......GT.G.A...........G.......

P.c.hominis

....................C.GC....C.....T...T.G..T....................C...........A..G

.G.C....A......GT...............G.......

 

                             610       620

                             .         .

 

P.c.muris           GCACAGCAACTGCAGTTGCTGCTTC

P.c.midas           .T..G...G....T........A..

P.c.callimico       .T..G........T........A..

P.c.fuscicollis     .T..G........T........A..

P.c.geoffroyi       .......GG....T........A..

P.c.aotus           ?????????????????????????

P.c.sciureus        .T..G...G....T.....A..A..

P.c.nigroviridis    .T..T..TG....T..A..C.TA..

P.c.hominis         ....T..TG..T.G.....C..A..

 

 

 

 

 

Appendix 3: mtSSU gene

 

 

[                              10        20        30        40        50

60        70        80        90        100       110       120]

[                              .         .         .         .         .

.         .         .         .         .         .         .  ]

 

P.c.muris

iiiiiiidi*****************ATAACCCCAGACAAATCTTACCACTTCTTGCid???i?iiiid???????????

ATAAT************************************

P.c.macaco

......d?..................*****..AC.CT....................idii.i..d???????iiii??

...............TTAGATTACCTTTTCAAGATTTCATT

P.c.hominis

.................................AC..T...................d????.??...iid?????????

...T.....................................

P.c.rhesus

......d?..................*****..AC..T....................iidid???.?i?i???d?????

...G.CA...............GGT.TATATATTA......

P.c.mulatta

.......i.GCATGTTGTTTTATTCG.......AC..T....T...............iidid???.?i?i???d?????

...G.CA...............GGT.TATATATTA......

P.c.fascicularis

......d?..................*****..AC..T..................T.iidi.i...di?i?i?iiii??

...G.CA...............GGTTTATATATTATTTATT

P.c.hamlyni

......d?..................*****..AC..T....................iidi.i.d.?i?i?i?iidi??

...G.CA...............AGTTTTATTAATATTTA..

P.c.pithecia

...d????..................***********.TCTC.GA.TACTA.G.....iiid.id...idi?ddi???i?

*****...TACT..ATCGCTCTGGTGTTC............

P.c.midas

d???????..................************************........iiii.i....iiiiiiiiidid

...T.CATTACTTAATTCTAATGTTATAATAAGTATTTATG

P.c.oedipus

.....d??..................******.AC..T....................iiii.i....iiiiiiiiidid

...T.CATTACTTAATTCTAATGTTATAATAAGTATTTTTG

P.c.fuscicollis

????????d.................***************************...T.iiii.i....iiidiiiiiii?

...T.CATTACTTAATTTTACTGCTATTATTAGTACTAATG

P.c.callithrix

....d???..................*******AC..T....................iiii.d....iiiiiiididdi

...T.CATTACTTAATTCTACTGCTATTGTTAATACTT.TG

P.c.geoffroyi

..d?????..................*************...................iiii.d....iiiiiiididdi

...T.CATTACTTAATTCTACTGCTATTGTTAATACTT.TG

P.c.callimico

.d??????..................***********************.........iiii.i....iiidiiiiiii?

...T.CATTACTTAATTTTACTGCTATTATTAGTACTAATG

 

[                           130       140       150       160       170

180       190       200       210       220       230       240]

[                           .         .         .         .         .

.         .         .         .         .         .         .  ]

 

P.c.muris

*************************AGATTTATCT*********************************************

*****************ATTd*ACAGGTGTTGCATGGCTGT

P.c.macaco

TATTTAATAATAATTGAAATTATTG.A.AC..A**.............................................

.........................................

P.c.hominis

.........................**********........................TTCCTATTCGG..........

................A...iT...................

P.c.rhesus

.........................**********.............................................

.......TTATATATTG........................

P.c.mulatta

.........................**********.............................................

.......TTATATATTG........................

P.c.fascicularis

TAATAATATTCATATATATTAATTTGA..AATAT*.............................................

..ATTTATTATATATTG........................

P.c.hamlyni       ..GTTAGTATTCTAACTTATTAA.CTGT.*******.............................................

...ATATTTATATATTG........................

P.c.pithecia

......CACTTCCACGTGGTA....*******CTCCAGTTTCG.ATCCTGGTTTTTAGTTACTCGC..............

..TG.AGTCTTATCATG........................

P.c.midas

CTT.TAAACATTATTGATGCTAAGA...C..G.TCTTCTTACGTTTCCTTTTTGTGAGATGCTTAAGTGTTTATCTTA.T

AATGTAGTTTTATCATG........................

P.c.oedipus

CTT.CTAACATAATTGAAGCAAAGA......G.TCTTCTTCTGTTTCCTTTTTGTGAGATGCTTAAGTGTTTATGTTA.T

AATGTAGTTTTATCATG........................

P.c.fuscicollis

GTTTCTAACGTTCAGGGTTCTAAGTT.......TCTTCTTACGTTCTCTTATTGTAAGATGCCTGTGTGTTGATATT..T

AGTGTATTCTTATCATG........................

P.c.callithrix

TTT.ATAACATTCA.GGTGTTAAGA........TCTGCTTAT.TTTCCTTTTTGTTAGTTGTTTAAGTGTTGATGTTGTT

AGTATAGTTTTATCATG........................

P.c.geoffroyi

TTT.ATAACATTCA.GGTGTTAAGA........TCTGCTTAT.TTTCCTTTTTGTTAGTTGTTTAAGTGTTGATGTTGTT

AGTATAGTTTTATCATG........................

P.c.callimico

GTTTCTAACGTTCAGGGTTCTAAGTT.......TCTTCTTACGTTCTCTTATTGTAAGATTCCTGTGTGTTGATATT..T

AGTGTAGTCTTATCATG........................

 

[                         250       260       270       280       290

300       310       320       330       340       350       360 ]

[                         .         .         .         .         .         .

.         .         .         .         .         .   ]

 

P.c.muris

CTTTAGTTCGTGTTGTd*AAATGTAAGGTTCATTCCGAGAACGAACGCAATCCTTATCTTTAATTAAid?????i?i?id

??????A**********************************

P.c.macaco

................iG......T.....T.......T........T..C..............TT.iidiiid?????

???i??.TA.............................TAT

P.c.hominis

................iG......T.....T...T...T........T..A....G..C.......Td????????????

??????T..................................

P.c.rhesus

................iG......T.....A.......A...........A...............T.iiiidi.i.i.i

d??iidTTATTATTTAATTGTT.TTTTTTGTT........T

P.c.mulatta

................iG......T.....A.......A...........A...............T.iiiidi.i.i.i

???iddTTATTATTTAATTGTT....TTTGTT........T

P.c.fascicularis

................iG......T.....A.......A...........A...............T.iiiiii.i.i.i

iiiiidTTATTACTTAATTGTTTTTTTTTATTTGTTTAAAT

P.c.hamlyni

................iG......T.....A.......A...........A.......C.......T.iiid?i.i.i.i

i??iidTTATTCCTTAATTGTTTTCTT..............

P.c.pithecia

..C.............iG......T.....A.......A................C..........G.idid?i.id?.?

???ii?T................TCTC..............

P.c.midas

................iG......T.....A.......A...........C....T..........T.iiiiii.d.d.i

ididid*..........CTGTTGTTTCTTGTT.GT...AAT

P.c.oedipus

................iG......T.....A.......A...........C....C..........T.iiiiid.d.d.i

idi?id*..........CTGTTGTTTCTTGTT.GT...AAT

P.c.fuscicollis

................iG......T.....A.......A...........C....C..........T.iiiiii.d.idi

idiiid*..........CTGTTGTTTCTTGTT.GT...TAT

P.c.callithrix

................iG......T.....A.......A...........C....T..........T.iiiiii.d.i.i

ddiiid*..........CTGTT.TCTCTTGTT.GT...AAT

P.c.geoffroyi

................iG......T.....A.......A...........C....T..........T.iiiiii.d.i.i

ddiiid*..........CTGTT.TCTCTTGTT.GT...AAT

P.c.callimico

................iG......T.....A.......A...........C....C..........T.iiiiii.d.idi

idiiid*..........CTGTTGTTTCTTGTT.GT...AAT

 

[                     370       380       390       400       410

420       430       440       450       460       470       480  ]

[                     .         .         .         .         .

.         .         .         .         .         .         .    ]

 

P.c.muris

*****************TTCT***TTAAAGAAGTATCTTTCGATAAGAAGGAATiiiiiiiidddAATTAGGATGAAGAC

AAGTCCTCATGACCCTTATGGAGTGGGCTACAGACGTGCCG

P.c.macaco

AATATAAC.........****...........A...TC..............G...........i...............

....................A...................A

P.c.hominis

.................****.......G...A.G...A......TT.TA..TG.........i................

....................A..................T.

P.c.rhesus        AAAAAAAAAAGTTAAGT.GT.TA.........A.G....A......TT.TA..............i..C................................A...............

...T.

P.c.mulatta

AAAAAAAAA.GTTAAGT.GT.TA.........A.G...A......TT.TA..........d...?..C............

....................A..................T.

P.c.fascicularis

AAATTTAAAAGTTAAGT.GT.TA.........A.G...A......TT.TA....???????d???***************

*****************************************

P.c.hamlyni

AAAAAAAAAAGTTAAGT.AT.TA.....G...A.G...A.....TTT.TAA.......d??...?..C.........A..

....................A..................T.

P.c.pithecia

AAAAAAAAAGATCA...*..*..........TA.G...GC...G.T.GTA...G.....d?.i.?.........T.....

....................A...................A

P.c.midas

AA.TTTATACTT.GA......TA........TA.G...GC.....T.GT....C..d????.???...............

....................A...................A

P.c.oedipus

A..TTTATACTT.GA......TA........TA.G...GC.....T.GT....Cd??????.???...............

....................A.......*************

P.c.fuscicollis

AACTTTACACTT.GAA.**T.TA........TA.G...GC.....T.GT....C...d???.???...............

....................A...................A

P.c.callithrix

AGCTTTACACTT.GGTT..T.TA........TA.G...GC.....T.GT....Cd??????.???...............

....................A.......*************

P.c.geoffroyi

AGCTTTACACTT.GGTT..T.TA........TA.G...GC.....T.GT....C.d?????.???...............

....................A.............*******

P.c.callimico

AACTTTACACTT.GAA.**T.TA........TA.G...GC.....T.GT....C...d???.???...............

....................A...................A

 

[                     490       500       510       520       530

540       550       560       570       580]

[                  .         .         .         .         .         .

.         .         .         .  ]

 

P.c.muris

CAAAAATTTCTACAATGGGAAGCAAAGATCC*AATTCCGAGCCAAT*CCTTAAAAGAAATTAAAGTACGGATAAGAAT**

******************

P.c.macaco

...............AA...T........GA...G..A....T..A....C...........................CT

GAAACTCGATTCTTTGAA

P.c.hominis

.....T..............T....T...GG...G..G....T...C..C.......TTG.TT...C........TGC..

..................

P.c.rhesus

.....G..............T........TA...A..A....T..............T...TT...C........TGCCT

GAAACTCGATTCTTTGAA

P.c.mulatta

.....G..............T........TA...A..A....T......C.......T...TT...************..

..................

P.c.fascicularis

*******************************.**************.*******************************..

..................

P.c.hamlyni

.....G..............T........TA...A..A....T..........*************************..

..................

P.c.pithecia

.....G...T..........T........T.ATTAA.T....T......C......TT.C.CC..*************..

..................

P.c.midas

....***************************.**************.*******************************..

..................

P.c.oedipus

*******************************.**************.*******************************..

..................

P.c.fuscicollis

.....**************************.**************.*******************************..

..................

P.c.callithrix

*******************************.**************.*******************************..

..................

P.c.geoffroyi

*******************************.**************.*******************************..

..................

P.c.callimico

.....**************************.**************.*******************************..

..................