http://hydrodictyon.eeb.uconn.edu/eebedia/index.php?title=Phylogenetics:_NEXUS_Format&feed=atom&action=history
Phylogenetics: NEXUS Format - Revision history
2024-03-29T00:24:24Z
Revision history for this page on the wiki
MediaWiki 1.25.2
http://hydrodictyon.eeb.uconn.edu/eebedia/index.php?title=Phylogenetics:_NEXUS_Format&diff=29153&oldid=prev
Paul Lewis at 18:59, 30 March 2014
2014-03-30T18:59:30Z
<p></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 18:59, 30 March 2014</td>
</tr><tr><td colspan="2" class="diff-lineno" id="L2" >Line 2:</td>
<td colspan="2" class="diff-lineno">Line 2:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|-</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|-</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|rowspan="2" valign="top"|[[Image:Adiantum.png|150px]]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|rowspan="2" valign="top"|[[Image:Adiantum.png|150px]]</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>|<span style="font-size: x-large">[http://<del class="diffchange diffchange-inline">hydrodictyon.eeb</del>.uconn.edu/<del class="diffchange diffchange-inline">eebedia/index.php</del>/<del class="diffchange diffchange-inline">Phylogenetics:_Syllabus </del>EEB 5349: Phylogenetics]</span></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>|<span style="font-size: x-large">[http://<ins class="diffchange diffchange-inline">phylogeny</ins>.uconn.edu/<ins class="diffchange diffchange-inline">courses</ins>/ EEB 5349: Phylogenetics]</span></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|-</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|-</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|The goal here is to explain the most important features of the NEXUS file format commonly used in phylogenetics. There are no lab exercises here, just information. Use this as a reference.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|The goal here is to explain the most important features of the NEXUS file format commonly used in phylogenetics. There are no lab exercises here, just information. Use this as a reference.</div></td></tr>
</table>
Paul Lewis
http://hydrodictyon.eeb.uconn.edu/eebedia/index.php?title=Phylogenetics:_NEXUS_Format&diff=16881&oldid=prev
PaulLewis at 14:50, 18 January 2011
2011-01-18T14:50:15Z
<p></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 14:50, 18 January 2011</td>
</tr><tr><td colspan="2" class="diff-lineno" id="L2" >Line 2:</td>
<td colspan="2" class="diff-lineno">Line 2:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|-</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|-</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|rowspan="2" valign="top"|[[Image:Adiantum.png|150px]]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|rowspan="2" valign="top"|[[Image:Adiantum.png|150px]]</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>|<span style="font-size: x-large">[http://hydrodictyon.eeb.uconn.edu/eebedia/index.php/Phylogenetics:_Syllabus EEB <del class="diffchange diffchange-inline">349</del>: Phylogenetics]</span></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>|<span style="font-size: x-large">[http://hydrodictyon.eeb.uconn.edu/eebedia/index.php/Phylogenetics:_Syllabus EEB <ins class="diffchange diffchange-inline">5349</ins>: Phylogenetics]</span></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|-</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|-</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|The goal here is to explain the most important features of the NEXUS file format commonly used in phylogenetics. There are no lab exercises here, just information. Use this as a reference.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|The goal here is to explain the most important features of the NEXUS file format commonly used in phylogenetics. There are no lab exercises here, just information. Use this as a reference.</div></td></tr>
</table>
PaulLewis
http://hydrodictyon.eeb.uconn.edu/eebedia/index.php?title=Phylogenetics:_NEXUS_Format&diff=11921&oldid=prev
PaulLewis at 23:25, 28 April 2009
2009-04-28T23:25:41Z
<p></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 23:25, 28 April 2009</td>
</tr><tr><td colspan="2" class="diff-lineno" id="L177" >Line 177:</td>
<td colspan="2" class="diff-lineno">Line 177:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>   quit;   </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>   quit;   </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  end;</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  end;</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">[[Category:Phylogenetics]]</ins></div></td></tr>
</table>
PaulLewis
http://hydrodictyon.eeb.uconn.edu/eebedia/index.php?title=Phylogenetics:_NEXUS_Format&diff=9864&oldid=prev
PaulLewis at 14:34, 22 January 2009
2009-01-22T14:34:29Z
<p></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 14:34, 22 January 2009</td>
</tr><tr><td colspan="2" class="diff-lineno" id="L115" >Line 115:</td>
<td colspan="2" class="diff-lineno">Line 115:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>   taxset gnetales = Ephedra Gnetum Welwitschia;</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>   taxset gnetales = Ephedra Gnetum Welwitschia;</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  end;</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  end;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>This sets block defines both a set of characters (in this case the sites composing the trnL intron) and a set of taxa (consisting of the three genera in the seed plant order Gnetales: Ephedra, Gnetum and Welwitschia). We could have used the taxon numbers for the taxset definition (e.g., <tt>taxset gnetales = 1-3;</tt>) but using the actual names is clearer and less prone to error (just think of what might happen if you decided to reorder your sequences!). These definitions may be used in other blocks. A common use is in commands placed inside a paup block (see below) or typed directly at the PAUP* command prompt.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>This sets block defines both a set of characters (in this case the sites composing the trnL intron) and a set of taxa (consisting of the three genera in the seed plant order Gnetales: Ephedra, Gnetum and Welwitschia). We could have used the taxon numbers for the taxset definition (e.g., <tt>taxset gnetales = 1-3;</tt>) but using the actual names is clearer and less prone to error (just think of what might happen if you decided to reorder your sequences!). These definitions may be used in other blocks. A common use is in commands placed inside a <ins class="diffchange diffchange-inline"><tt></ins>paup<ins class="diffchange diffchange-inline"></tt> </ins>block (see below) or typed directly at the PAUP* command prompt.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==== Assumptions block ====</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==== Assumptions block ====</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>There is only one command I will introduce from the assumptions block (although there are a number of others that exist). The exset command (the word exset stands for "exclusion set") is useful for creating a set of characters that are automatically excluded whenever the data file is executed. Given the following block:</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>There is only one command I will introduce from the assumptions block (although there are a number of others that exist). The <ins class="diffchange diffchange-inline"><tt></ins>exset<ins class="diffchange diffchange-inline"></tt> </ins>command (the word exset stands for "exclusion set") is useful for creating a set of characters that are automatically excluded whenever the data file is executed. Given the following block:</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  #nexus</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  #nexus</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  ...</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  ...</div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="L142" >Line 142:</td>
<td colspan="2" class="diff-lineno">Line 142:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  end;</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  end;</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Here is what each line does:</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Here is what each line does:</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* The log command starts a log file (the file will be called myoutput.txt and will be overwritten if it already exists)</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The <ins class="diffchange diffchange-inline"><tt></ins>log<ins class="diffchange diffchange-inline"></tt> </ins>command starts a log file (the file will be called myoutput.txt and will be overwritten if it already exists)</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* The outgroup command specifies that the resulting trees should be rooted between Ephedra and everything else (this just affects the appearance of the tree when drawn)</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The <ins class="diffchange diffchange-inline"><tt></ins>outgroup<ins class="diffchange diffchange-inline"></tt> </ins>command specifies that the resulting trees should be rooted between Ephedra and everything else (this just affects the appearance of the tree when drawn)</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* The set command changes the optimality criterion from the default (parsimony) to maximum likelihood</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The <ins class="diffchange diffchange-inline"><tt></ins>set<ins class="diffchange diffchange-inline"></tt> </ins>command changes the optimality criterion from the default (parsimony) to maximum likelihood</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* The lset command sets up PAUP* so that the HKY85 model will be used (number of substitution rates is 2, empirical base frequencies, rates are homogeneous across sites, estimate the transition/transversion ratio, and use the HKY model rather than the other, similar F84 model)</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The <ins class="diffchange diffchange-inline"><tt></ins>lset<ins class="diffchange diffchange-inline"></tt> </ins>command sets up PAUP* so that the HKY85 model will be used (number of substitution rates is 2, empirical base frequencies, rates are homogeneous across sites, estimate the transition/transversion ratio, and use the HKY model rather than the other, similar F84 model)</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* The hsearch command causes PAUP* to conduct 100 heuristic searches (each beginning from a different, random starting tree); each search will start with a stepwise addition tree using random addition of taxa, and this starting tree will be rearranged using the tree bisection/reconnection branch swapping method</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The <ins class="diffchange diffchange-inline"><tt></ins>hsearch<ins class="diffchange diffchange-inline"></tt> </ins>command causes PAUP* to conduct 100 heuristic searches (each beginning from a different, random starting tree); each search will start with a stepwise addition tree using random addition of taxa, and this starting tree will be rearranged using the tree bisection/reconnection branch swapping method</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* The describe command produces a depiction of the tree (rooted at the specified outgroup) on the output (and in the log file, since we opened a log file earlier); the tree will be shown as a phylogram, which means branch lengths will appear proportional to the average number of nucleotide substitutions per site that were inferred for that branch.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The <ins class="diffchange diffchange-inline"><tt></ins>describe<ins class="diffchange diffchange-inline"></tt> </ins>command produces a depiction of the tree (rooted at the specified outgroup) on the output (and in the log file, since we opened a log file earlier); the tree will be shown as a phylogram, which means branch lengths will appear proportional to the average number of nucleotide substitutions per site that were inferred for that branch.</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* The savetrees command saves the best tree found during the search (this is quite important and easy to forget to do!). The brlens keyword tells PAUP to save branch length information along with the tree topology.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The <ins class="diffchange diffchange-inline"><tt></ins>savetrees<ins class="diffchange diffchange-inline"></tt> </ins>command saves the best tree found during the search (this is quite important and easy to forget to do!). The <ins class="diffchange diffchange-inline"><tt></ins>brlens<ins class="diffchange diffchange-inline"></tt> </ins>keyword tells PAUP to save branch length information along with the tree topology.</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* The log command stops the logging of output to the file myoutput.txt</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The <ins class="diffchange diffchange-inline"><tt></ins>log<ins class="diffchange diffchange-inline"></tt> </ins>command stops the logging of output to the file myoutput.txt</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* The quit command causes PAUP* to quit running; if you left out this command, PAUP* would remain running at this point, allowing you to issue other commands</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The <ins class="diffchange diffchange-inline"><tt></ins>quit<ins class="diffchange diffchange-inline"></tt> </ins>command causes PAUP* to quit running; if you left out this command, PAUP* would remain running at this point, allowing you to issue other commands</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Note that because PAUP* ignores blocks whose names it does not recognize, you can easily "comment out" a paup block by simply adding a character to its name. For example, adding an underscore</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Note that because PAUP* ignores blocks whose names it does not recognize, you can easily "comment out" a paup block by simply adding a character to its name. For example, adding an underscore</div></td></tr>
</table>
PaulLewis
http://hydrodictyon.eeb.uconn.edu/eebedia/index.php?title=Phylogenetics:_NEXUS_Format&diff=9863&oldid=prev
PaulLewis at 14:31, 22 January 2009
2009-01-22T14:31:39Z
<p></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 14:31, 22 January 2009</td>
</tr><tr><td colspan="2" class="diff-lineno" id="L18" >Line 18:</td>
<td colspan="2" class="diff-lineno">Line 18:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  ...</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  ...</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  end;</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  end;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>Note that the elipsis (...) is never used in a Nexus data file; it is used here simply to indicate that some text has been omitted. The name of the Nexus block used as an example above is <tt>characters</tt>. Because Nexus data files are organized in named blocks, PAUP* and other programs are able to read blocks whose names they recognize and ignore blocks that are not recognized. This allows many different programs to use the same overall format without crashing when they encounter data they cannot interpret.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>Note that the elipsis (<ins class="diffchange diffchange-inline"><tt></ins>...<ins class="diffchange diffchange-inline"></tt></ins>) is never used in a Nexus data file; it is used here simply to indicate that some text has been omitted. The name of the Nexus block used as an example above is <tt>characters</tt>. Because Nexus data files are organized in named blocks, PAUP* and other programs are able to read blocks whose names they recognize and ignore blocks that are not recognized. This allows many different programs to use the same overall format without crashing when they encounter data they cannot interpret.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>=== Nexus commands ===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>=== Nexus commands ===</div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="L52" >Line 52:</td>
<td colspan="2" class="diff-lineno">Line 52:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  end;</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  end;</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Note that there are four commands in this example of a taxa block. Can you find the terminating semicolon for each of them?</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Note that there are four commands in this example of a taxa block. Can you find the terminating semicolon for each of them?</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* the begin command giving the block's name</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* the <ins class="diffchange diffchange-inline"><tt></ins>begin<ins class="diffchange diffchange-inline"></tt> </ins>command giving the block's name</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* the dimensions command giving the number of taxa</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* the <ins class="diffchange diffchange-inline"><tt></ins>dimensions<ins class="diffchange diffchange-inline"></tt> </ins>command giving the number of taxa</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* the taxlabels command providing the actual taxon labels</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* the <ins class="diffchange diffchange-inline"><tt></ins>taxlabels<ins class="diffchange diffchange-inline"></tt> </ins>command providing the actual taxon labels</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* the end command, telling PAUP* that there are no more commands to process for this block</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* the <ins class="diffchange diffchange-inline"><tt></ins>end<ins class="diffchange diffchange-inline"></tt> </ins>command, telling PAUP* that there are no more commands to process for this block</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==== Data block ====</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==== Data block ====</div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="L74" >Line 74:</td>
<td colspan="2" class="diff-lineno">Line 74:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  end;</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  end;</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Some things to note in this example are:</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Some things to note in this example are:</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* The dimensions command comes first in a data block, and specifies the number of sequences (taxa; ntax) and number of sites (characters; nchar).</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The <ins class="diffchange diffchange-inline"><tt></ins>dimensions<ins class="diffchange diffchange-inline"></tt> </ins>command comes first in a data block, and specifies the number of sequences (taxa; ntax) and number of sites (characters; nchar).</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* The format command tells PAUP* what kind of data follow (dna, rna, protein, or standard), and provides the symbols used for missing data (?) and gaps (-).</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The <ins class="diffchange diffchange-inline"><tt></ins>format<ins class="diffchange diffchange-inline"></tt> </ins>command tells PAUP* what kind of data follow (dna, rna, protein, or standard), and provides the symbols used for missing data (?) and gaps (-).</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* The matrix command dominates the data block, providing the sequences themselves (as well as the taxon names). Note the semicolon terminating the matrix command!!!</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The <ins class="diffchange diffchange-inline"><tt></ins>matrix<ins class="diffchange diffchange-inline"></tt> </ins>command dominates the data block, providing the sequences themselves (as well as the taxon names). Note the semicolon terminating the matrix command!!!</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* You can use upper or lower case symbols for nucleotides</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* You can use upper or lower case symbols for nucleotides</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* You can place whitespace anywhere except inside a taxon name or keyword (e.g., data type = dna would cause problems because datatype should not have embedded whitespace).</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* You can place whitespace anywhere except inside a taxon name or keyword (e.g., <ins class="diffchange diffchange-inline"><tt></ins>data type = dna<ins class="diffchange diffchange-inline"></tt> </ins>would cause problems because <ins class="diffchange diffchange-inline"><tt></ins>datatype<ins class="diffchange diffchange-inline"></tt> </ins>should not have embedded whitespace).</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* If you simply must have a space in one of your taxon names, either use an underscore character in place of the space (e.g., <tt>Ginkgo_biloba</tt>) or surround the taxon name in single quotes (e.g., <tt>'Ginkgo biloba'</tt>). In either case, PAUP* will output the space in its output.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* If you simply must have a space in one of your taxon names, either use an underscore character in place of the space (e.g., <tt>Ginkgo_biloba</tt>) or surround the taxon name in single quotes (e.g., <tt>'Ginkgo biloba'</tt>). In either case, PAUP* will output the space in its output.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* One item missing from the format command in the example above but which is quite useful is something known as an equate list. The following format statement will cause all occurrences of T to be changed to C and all occurrences of G to be changed to A as the data are being read into PAUP*:</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* One item missing from the format command in the example above but which is quite useful is something known as an equate list. The following format statement will cause all occurrences of T to be changed to C and all occurrences of G to be changed to A as the data are being read into PAUP*:</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  format datatype=dna missing=? gap=- equate="T=C G=A";</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  format datatype=dna missing=? gap=- equate="T=C G=A";</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>This is like telling PAUP* to do a search-and-replace operation on the sequences before reading them in, except that your original file remains intact. Be careful when using equate, because the replacement is case sensitive (i.e., equate="t=c g=a" would have had no effect if all the nucleotides are represented by upper case letters!).</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>This is like telling PAUP* to do a search-and-replace operation on the sequences before reading them in, except that your original file remains intact. Be careful when using equate, because the replacement is case sensitive (i.e., <ins class="diffchange diffchange-inline"><tt></ins>equate="t=c g=a"<ins class="diffchange diffchange-inline"></tt> </ins>would have had no effect if all the nucleotides are represented by upper case letters!).</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* PAUP* recognizes all the standard ambiguity codes (e.g., R for purine, Y for pyrimidine, N for undetermined, etc.).</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* PAUP* recognizes all the standard ambiguity codes (e.g., R for purine, Y for pyrimidine, N for undetermined, etc.).</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td colspan="2" class="diff-lineno" id="L101" >Line 101:</td>
<td colspan="2" class="diff-lineno">Line 101:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  end;</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  end;</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Some things to note in this example are:</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Some things to note in this example are:</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* The translate command provides short alternatives to the taxon names, making the tree descriptions shorter (takes up fewer bytes of disk space).</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The <ins class="diffchange diffchange-inline"><tt></ins>translate<ins class="diffchange diffchange-inline"></tt> </ins>command provides short alternatives to the taxon names, making the tree descriptions shorter (takes up fewer bytes of disk space).</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* the translate command is not necessary however; it is ok to use the taxon names directly in the tree descriptions</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* the translate command is not necessary however; it is ok to use the taxon names directly in the tree descriptions</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* the tree command denotes the start of a tree description, which consists of a tree name (e.g., one and two are used here), followed by an equals sign and then the tree topology in the standard, parenthetical notation (often referred to as the Newick or New Hampshire format).</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* the <ins class="diffchange diffchange-inline"><tt></ins>tree<ins class="diffchange diffchange-inline"></tt> </ins>command denotes the start of a tree description, which consists of a tree name (e.g., <ins class="diffchange diffchange-inline"><tt></ins>one<ins class="diffchange diffchange-inline"></tt> </ins>and <ins class="diffchange diffchange-inline"><tt></ins>two<ins class="diffchange diffchange-inline"></tt> </ins>are used here), followed by an equals sign and then the tree topology in the standard, parenthetical notation (often referred to as the Newick or New Hampshire format).</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* The special comments consisting of an ampersand symbol followed by the letter U tell PAUP* to interpret the tree as being an unrooted tree.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* The special comments consisting of an ampersand symbol followed by the letter U tell PAUP* to interpret the tree as being an unrooted tree.</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* Files containing only the #nexus plus a trees block are called tree files</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* Files containing only the <ins class="diffchange diffchange-inline"><tt></ins>#nexus<ins class="diffchange diffchange-inline"></tt> </ins>plus a trees block are called tree files</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==== Sets block ====</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==== Sets block ====</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>The only commands you need to know at this point from a sets block are the charset and the taxset commands.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>The only commands you need to know at this point from a sets block are the <ins class="diffchange diffchange-inline"><tt></ins>charset<ins class="diffchange diffchange-inline"></tt> </ins>and the <ins class="diffchange diffchange-inline"><tt></ins>taxset<ins class="diffchange diffchange-inline"></tt> </ins>commands.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  #nexus</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  #nexus</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  ...</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  ...</div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="L115" >Line 115:</td>
<td colspan="2" class="diff-lineno">Line 115:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>   taxset gnetales = Ephedra Gnetum Welwitschia;</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>   taxset gnetales = Ephedra Gnetum Welwitschia;</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  end;</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  end;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>This sets block defines both a set of characters (in this case the sites composing the trnL intron) and a set of taxa (consisting of the three genera in the seed plant order Gnetales: Ephedra, Gnetum and Welwitschia). We could have used the taxon numbers for the taxset definition (e.g., taxset gnetales = 1-3;) but using the actual names is clearer and less prone to error (just think of what might happen if you decided to reorder your sequences!). These definitions may be used in other blocks. A common use is in commands placed inside a paup block (see below) or typed directly at the PAUP* command prompt.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>This sets block defines both a set of characters (in this case the sites composing the trnL intron) and a set of taxa (consisting of the three genera in the seed plant order Gnetales: Ephedra, Gnetum and Welwitschia). We could have used the taxon numbers for the taxset definition (e.g., <ins class="diffchange diffchange-inline"><tt></ins>taxset gnetales = 1-3;<ins class="diffchange diffchange-inline"></tt></ins>) but using the actual names is clearer and less prone to error (just think of what might happen if you decided to reorder your sequences!). These definitions may be used in other blocks. A common use is in commands placed inside a paup block (see below) or typed directly at the PAUP* command prompt.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==== Assumptions block ====</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==== Assumptions block ====</div></td></tr>
</table>
PaulLewis
http://hydrodictyon.eeb.uconn.edu/eebedia/index.php?title=Phylogenetics:_NEXUS_Format&diff=9849&oldid=prev
PaulLewis: /* Commonly-used Nexus blocks */
2009-01-21T23:53:36Z
<p><span dir="auto"><span class="autocomment">Commonly-used Nexus blocks</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 23:53, 21 January 2009</td>
</tr><tr><td colspan="2" class="diff-lineno" id="L35" >Line 35:</td>
<td colspan="2" class="diff-lineno">Line 35:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Here is a list of common Nexus blocks and the most-common commands within these blocks. For a complete description of the Nexus file format, take a look at this paper:</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Here is a list of common Nexus blocks and the most-common commands within these blocks. For a complete description of the Nexus file format, take a look at this paper:</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><div style="background-color: #aaeeee; padding: 5px;">Maddison, David R., Swofford, David L. and Maddison, Wayne P. 1997. NEXUS: an extensible file format for systematic information. Systematic Biology 46: 590-621<del class="diffchange diffchange-inline">. {{pdf|http://hydrodictyon.eeb.uconn.edu/people/plewis/courses/phylogenetics/restricted/Maddison_Swofford_Maddison_1997_SystBiol_46_590-621.pdf}}</del></div></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><div style="background-color: #aaeeee; padding: 5px;"><ins class="diffchange diffchange-inline">[http://www.jstor.org/stable/2413497 </ins>Maddison, David R., Swofford, David L. and Maddison, Wayne P. 1997. NEXUS: an extensible file format for systematic information. Systematic Biology 46: 590-621<ins class="diffchange diffchange-inline">]</ins></div></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==== Taxa block ====</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==== Taxa block ====</div></td></tr>
</table>
PaulLewis
http://hydrodictyon.eeb.uconn.edu/eebedia/index.php?title=Phylogenetics:_NEXUS_Format&diff=9848&oldid=prev
PaulLewis: /* Commonly-used Nexus blocks */
2009-01-21T23:40:59Z
<p><span dir="auto"><span class="autocomment">Commonly-used Nexus blocks</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 23:40, 21 January 2009</td>
</tr><tr><td colspan="2" class="diff-lineno" id="L35" >Line 35:</td>
<td colspan="2" class="diff-lineno">Line 35:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Here is a list of common Nexus blocks and the most-common commands within these blocks. For a complete description of the Nexus file format, take a look at this paper:</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Here is a list of common Nexus blocks and the most-common commands within these blocks. For a complete description of the Nexus file format, take a look at this paper:</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><div style="background-color: #aaeeee; padding: 5px;">Maddison, David R., Swofford, David L. and Maddison, Wayne P. 1997. NEXUS: an extensible file format for systematic information. Systematic Biology 46: 590-621</div></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><div style="background-color: #aaeeee; padding: 5px;">Maddison, David R., Swofford, David L. and Maddison, Wayne P. 1997. NEXUS: an extensible file format for systematic information. Systematic Biology 46: 590-621<ins class="diffchange diffchange-inline">. {{pdf|http://hydrodictyon.eeb.uconn.edu/people/plewis/courses/phylogenetics/restricted/Maddison_Swofford_Maddison_1997_SystBiol_46_590-621.pdf}}</ins></div></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==== Taxa block ====</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==== Taxa block ====</div></td></tr>
</table>
PaulLewis
http://hydrodictyon.eeb.uconn.edu/eebedia/index.php?title=Phylogenetics:_NEXUS_Format&diff=9847&oldid=prev
PaulLewis at 23:28, 21 January 2009
2009-01-21T23:28:24Z
<p></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 23:28, 21 January 2009</td>
</tr><tr><td colspan="2" class="diff-lineno" id="L107" >Line 107:</td>
<td colspan="2" class="diff-lineno">Line 107:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Files containing only the #nexus plus a trees block are called tree files</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Files containing only the #nexus plus a trees block are called tree files</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>=== Sets block ===</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">=</ins>=== Sets block <ins class="diffchange diffchange-inline">=</ins>===</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>The only commands you need to know at this point from a sets block are the charset and the taxset commands.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>The only commands you need to know at this point from a sets block are the charset and the taxset commands.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  #nexus</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  #nexus</div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="L115" >Line 115:</td>
<td colspan="2" class="diff-lineno">Line 115:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>   taxset gnetales = Ephedra Gnetum Welwitschia;</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>   taxset gnetales = Ephedra Gnetum Welwitschia;</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  end;</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  end;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;"></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>This sets block defines both a set of characters (in this case the sites composing the trnL intron) and a set of taxa (consisting of the three genera in the seed plant order Gnetales: Ephedra, Gnetum and Welwitschia). We could have used the taxon numbers for the taxset definition (e.g., taxset gnetales = 1-3;) but using the actual names is clearer and less prone to error (just think of what might happen if you decided to reorder your sequences!). These definitions may be used in other blocks. A common use is in commands placed inside a paup block (see below) or typed directly at the PAUP* command prompt.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>This sets block defines both a set of characters (in this case the sites composing the trnL intron) and a set of taxa (consisting of the three genera in the seed plant order Gnetales: Ephedra, Gnetum and Welwitschia). We could have used the taxon numbers for the taxset definition (e.g., taxset gnetales = 1-3;) but using the actual names is clearer and less prone to error (just think of what might happen if you decided to reorder your sequences!). These definitions may be used in other blocks. A common use is in commands placed inside a paup block (see below) or typed directly at the PAUP* command prompt.</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">Assumptions block</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">There is only one command I will introduce from the assumptions block (although there are a number of others that exist). The exset command (the word exset stands for exclusion set) is useful for creating a set of characters that are automatically excluded whenever the data file is executed. Given the following block:</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;"></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">#nexus</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">...</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">begin assumptions;</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">  exset* badsites = 1 5 47-.;</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">end;</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">==== Assumptions block ====</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">There is only one command I will introduce from the assumptions block (although there are a number of others that exist). The exset command (the word exset stands for "exclusion set") is useful for creating a set of characters that are automatically excluded whenever the data file is executed. Given the following block:</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> #nexus</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> ...</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> begin assumptions;</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">  exset* badsites = 1 5 47-.;</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> end;</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>PAUP* would automatically exclude characters (i.e., sites) 1, 5, and 47 through the end of the sequence. It is the asterisk after the newterm exset that denotes this as the default exclusion set. If you left out the asterisk, PAUP* would define the exclusion set but would not automatically exclude these sites as the data file was being executed.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>PAUP* would automatically exclude characters (i.e., sites) 1, 5, and 47 through the end of the sequence. It is the asterisk after the newterm exset that denotes this as the default exclusion set. If you left out the asterisk, PAUP* would define the exclusion set but would not automatically exclude these sites as the data file was being executed.</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>Paup block</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">==== </ins>Paup block <ins class="diffchange diffchange-inline">====</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Paup blocks provide a way to give PAUP* commands from within a data file itself. Any command you can type at the command prompt or perform using menu commands you can place in the data file. This allows you to specify an entire analysis right in the data file. For any serious analysis, I always run PAUP* using a paup block. That way I know exactly what I did for a given analysis several days or weeks in the future. Paup blocks are also a handy way to perform certain commands every time the data file is executed. For example, you can set up your favorite likelihood substitution model, delete certain taxa or exclude certain sites from a paup block located just after your data block. Here is an example of a typical paup block:</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Paup blocks provide a way to give PAUP* commands from within a data file itself. Any command you can type at the command prompt or perform using menu commands you can place in the data file. This allows you to specify an entire analysis right in the data file. For any serious analysis, I always run PAUP* using a paup block. That way I know exactly what I did for a given analysis several days or weeks in the future. Paup blocks are also a handy way to perform certain commands every time the data file is executed. For example, you can set up your favorite likelihood substitution model, delete certain taxa or exclude certain sites from a paup block located just after your data block. Here is an example of a typical paup block:</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>#nexus</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>#nexus</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>...</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>...</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>begin paup;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>begin paup;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>log file=myoutput.txt start stop;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>log file=myoutput.txt start stop;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>outgroup Ephedra;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>outgroup Ephedra;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>set criterion=likelihood;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>set criterion=likelihood;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>lset nst=2 basefreq=empir rates=equal tratio=estim variant=hky;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>lset nst=2 basefreq=empir rates=equal tratio=estim variant=hky;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>hsearch swap=tbr addseq=random nreps=100 start=stepwise;  </div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>hsearch swap=tbr addseq=random nreps=100 start=stepwise;  </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>describe 1 / plot=phylogram;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>describe 1 / plot=phylogram;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>savetrees file=mytrees.tre brlens;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>savetrees file=mytrees.tre brlens;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>log stop;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>log stop;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>quit;   </div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>quit;   </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>end;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>end;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>Here is what each line does:</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The log command starts a log file (the file will be called myoutput.txt and will be overwritten if it already exists)</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>Here is what each line does <del class="diffchange diffchange-inline">(but don't worry too much about this since we will be talking much more about individual commands later in lab)</del>:</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The outgroup command specifies that the resulting trees should be rooted between Ephedra and everything else (this just affects the appearance of the tree when drawn)</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The set command changes the optimality criterion from the default (parsimony) to maximum likelihood</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>* The log command starts a log file (the file will be called myoutput.txt and will be overwritten if it already exists)</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The lset command sets up PAUP* so that the HKY85 model will be used (number of substitution rates is 2, empirical base frequencies, rates are homogeneous across sites, estimate the transition/transversion ratio, and use the HKY model rather than the other, similar F84 model)</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>* The outgroup command specifies that the resulting trees should be rooted between Ephedra and everything else (this just affects the appearance of the tree when drawn)</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The hsearch command causes PAUP* to conduct 100 heuristic searches (each beginning from a different, random starting tree); each search will start with a stepwise addition tree using random addition of taxa, and this starting tree will be rearranged using the tree bisection/reconnection branch swapping method</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>* The set command changes the optimality criterion from the default (parsimony) to maximum likelihood</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The describe command produces a depiction of the tree (rooted at the specified outgroup) on the output (and in the log file, since we opened a log file earlier); the tree will be shown as a phylogram, which means branch lengths will appear proportional to the average number of nucleotide substitutions per site that were inferred for that branch.</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>* The lset command sets up PAUP* so that the HKY85 model will be used (number of substitution rates is 2, empirical base frequencies, rates are homogeneous across sites, estimate the transition/transversion ratio, and use the HKY model rather than the other, similar F84 model)</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The savetrees command saves the best tree found during the search (this is quite important and easy to forget to do!). The brlens keyword tells PAUP to save branch length information along with the tree topology.</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>* The hsearch command causes PAUP* to conduct 100 heuristic searches (each beginning from a different, random starting tree); each search will start with a stepwise addition tree using random addition of taxa, and this starting tree will be rearranged using the tree bisection/reconnection branch swapping method</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The log command stops the logging of output to the file myoutput.txt</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>* The describe command produces a depiction of the tree (rooted at the specified outgroup) on the output (and in the log file, since we opened a log file earlier); the tree will be shown as a phylogram, which means branch lengths will appear proportional to the average number of nucleotide substitutions per site that were inferred for that branch.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The quit command causes PAUP* to quit running; if you left out this command, PAUP* would remain running at this point, allowing you to issue other commands</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>* The savetrees command saves the best tree found during the search (this is quite important and easy to forget to do!). The brlens keyword tells PAUP to save branch length information along with the tree topology.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>* The log command stops the logging of output to the file myoutput.txt</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>* The quit command causes PAUP* to quit running; if you left out this command, PAUP* would remain running at this point, allowing you to issue other commands</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Note that because PAUP* ignores blocks whose names it does not recognize, you can easily "comment out" a paup block by simply adding a character to its name. For example, adding an underscore</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Note that because PAUP* ignores blocks whose names it does not recognize, you can easily "comment out" a paup block by simply adding a character to its name. For example, adding an underscore</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>#nexus</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>#nexus</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>...</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>...</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>begin _paup;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>begin _paup;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>.</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>.</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>.</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>end;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>end;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>is enough to cause PAUP* to completely ignore this paup block. This is handy because it allows you to create multiple paup blocks for different purposes and turn them off and on whenever you need them.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>is enough to cause PAUP* to completely ignore this paup block. This is handy because it allows you to create multiple paup blocks for different purposes and turn them off and on whenever you need them.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>You can also "comment out" a portion of a paup block using the leave command. For example, in this paup block, PAUP* will be set up for doing a likelihood analysis but will not actually conduct the search; the leave command causes PAUP* to exit the block early:</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>You can also "comment out" a portion of a paup block using the leave command. For example, in this paup block, PAUP* will be set up for doing a likelihood analysis but will not actually conduct the search; the leave command causes PAUP* to exit the block early:</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>#nexus</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>#nexus</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>...</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>...</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>begin paup;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>begin paup;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>log file=myoutput.txt start stop;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>log file=myoutput.txt start stop;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>outgroup Ephedra;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>outgroup Ephedra;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>set criterion=likelihood;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>set criterion=likelihood;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>lset nst=2 basefreq=empir rates=equal tratio=estim variant=hky;  </div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>lset nst=2 basefreq=empir rates=equal tratio=estim variant=hky;  </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>leave;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>leave;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>hsearch swap=tbr addseq=random nreps=100 start=stepwise;  </div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>hsearch swap=tbr addseq=random nreps=100 start=stepwise;  </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>describe 1 / plot=phylogram;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>describe 1 / plot=phylogram;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>savetrees file=mytrees.tre brlens;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>savetrees file=mytrees.tre brlens;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>log stop;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>log stop;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>quit;   </div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>quit;   </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>end;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>end;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
</table>
PaulLewis
http://hydrodictyon.eeb.uconn.edu/eebedia/index.php?title=Phylogenetics:_NEXUS_Format&diff=9846&oldid=prev
PaulLewis: /* Taxa block */
2009-01-21T23:22:48Z
<p><span dir="auto"><span class="autocomment">Taxa block</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 23:22, 21 January 2009</td>
</tr><tr><td colspan="2" class="diff-lineno" id="L57" >Line 57:</td>
<td colspan="2" class="diff-lineno">Line 57:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* the end command, telling PAUP* that there are no more commands to process for this block</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* the end command, telling PAUP* that there are no more commands to process for this block</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>Data block</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">==== </ins>Data block <ins class="diffchange diffchange-inline">====</ins></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>The <del class="diffchange diffchange-inline">Data </del>block is the workhorse of Nexus blocks. This is where you place the actual sequence data, and, as mentioned above, this can also be where you define the names of your sequences. Here is an example of a <del class="diffchange diffchange-inline">Data </del>block:</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>The <ins class="diffchange diffchange-inline">data </ins>block is the workhorse of Nexus blocks. This is where you place the actual sequence data, and, as mentioned above, this can also be where you define the names of your sequences. Here is an example of a <ins class="diffchange diffchange-inline">data </ins>block:</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>#nexus</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>#nexus</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>...</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>...</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>begin data;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>begin data;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>dimensions ntax=5 nchar=54;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>dimensions ntax=5 nchar=54;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>format datatype=dna missing=? gap=-;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>format datatype=dna missing=? gap=-;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>matrix</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>matrix</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">    </ins>Ephedra      TTAAGCCATGCATGTCTAAGTATGAACTAATTCCAAACGGTGAAACTGCGGATG</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>Ephedra      TTAAGCCATGCATGTCTAAGTATGAACTAATTCCAAACGGTGAAACTGCGGATG</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">    </ins>Gnetum        TTAAGCCATGCATGTCTATGTACGAACTAATC-AGAACGGTGAAACTGCGGATG</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>Gnetum        TTAAGCCATGCATGTCTATGTACGAACTAATC-AGAACGGTGAAACTGCGGATG</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">    </ins>Welwitschia  TTAAGCCATGCACGTGTAAGTATGAACTAGTC-GAAACGGTGAAACTGCGGATG</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>Welwitschia  TTAAGCCATGCACGTGTAAGTATGAACTAGTC-GAAACGGTGAAACTGCGGATG</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">    </ins>Ginkgo        TTAAGCCATGCATGTGTAAGTATGAACTCTTTACAGACTGTGAAACTGCGAATG</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>Ginkgo        TTAAGCCATGCATGTGTAAGTATGAACTCTTTACAGACTGTGAAACTGCGAATG</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">    </ins>Pinus        TTAAGCCATGCATGTCTAAGTATGAACTAATTGCAGACTGTGAAACTGCGGATG</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>Pinus        TTAAGCCATGCATGTCTAAGTATGAACTAATTGCAGACTGTGAAACTGCGGATG</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">                  </ins>[----+--10|----+--20|----+--30|----+--40|----+--50|----]</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">                </del>[----+--10|----+--20|----+--30|----+--40|----+--50|----]</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>end;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>end;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Some things to note in this example are:</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Some things to note in this example are:</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">* The dimensions command comes first in a data block, and specifies the number of sequences (taxa; ntax) and number of sites (characters; nchar).</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">* The format command tells PAUP* what kind of data follow (dna, rna, protein, or standard), and provides the symbols used for missing data (?) and gaps (-).</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">* The matrix command dominates the data block, providing the sequences themselves (as well as the taxon names). Note the semicolon terminating the matrix command!!!</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">* You can use upper or lower case symbols for nucleotides</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">* You can place whitespace anywhere except inside a taxon name or keyword (e.g., data type = dna would cause problems because datatype should not have embedded whitespace).</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">* If you simply must have a space in one of your taxon names, either use an underscore character in place of the space (e.g., <tt>Ginkgo_biloba</tt>) or surround the taxon name in single quotes (e.g., <tt>'Ginkgo biloba'</tt>). In either case, PAUP* will output the space in its output.</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">* One item missing from the format command in the example above but which is quite useful is something known as an equate list. The following format statement will cause all occurrences of T to be changed to C and all occurrences of G to be changed to A as the data are being read into PAUP*:</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> format datatype=dna missing=? gap=- equate="T=C G=A";</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">This is like telling PAUP* to do a search-and-replace operation on the sequences before reading them in, except that your original file remains intact. Be careful when using equate, because the replacement is case sensitive (i.e., equate="t=c g=a" would have had no effect if all the nucleotides are represented by upper case letters!).</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">* PAUP* recognizes all the standard ambiguity codes (e.g., R for purine, Y for pyrimidine, N for undetermined, etc.).</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    * The dimensions command comes first in a Data block, and specifies the number of sequences (taxa; ntax) and number of sites (characters; nchar).</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>==== <ins class="diffchange diffchange-inline">Trees block </ins>====</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    * The format command tells PAUP* what kind of data follow (dna, rna, protein, or standard), and provides the symbols used for missing data (?) and gaps (-).</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>A <ins class="diffchange diffchange-inline">trees </ins>block has the following structure:</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    * The matrix command dominates the Data block, providing the sequences themselves (as well as the taxon names). Note the semicolon terminating the matrix command!!!</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>#nexus</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    * You can use upper or lower case symbols for nucleotides</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>...</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    * You can place whitespace anywhere except inside a taxon name or keyword (e.g., data type </del>= <del class="diffchange diffchange-inline">dna would cause problems because datatype should not have embedded whitespace).</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>begin trees;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    * If you simply must have a space in one of your taxon names, either use an underscore character in place of the space (e.g., Ginkgo_biloba) or surround the taxon name in single quotes (e.g., 'Ginkgo biloba'). In either case, PAUP* will output the space in its output.</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>translate</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    * One item missing from the format command in the example above but which is quite useful is something known as an equate list. The following format statement will cause all occurrences of T to be changed to C and all occurrences of G to be changed to A as the data are being read into PAUP*:</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">    </ins>1 Ephedra,</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">    </ins>2 Gnetum,</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">    </ins>3 Welwitschia,</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">      format datatype</del>=<del class="diffchange diffchange-inline">dna missing</del>=<del class="diffchange diffchange-inline">? gap</del>=<del class="diffchange diffchange-inline">- equate</del>=<del class="diffchange diffchange-inline">"T</del>=<del class="diffchange diffchange-inline">C G</del>=<del class="diffchange diffchange-inline">A";</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">    </ins>4 Ginkgo,</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">    </ins>5 Pinus</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">      This is like telling PAUP* to do a search-and-replace operation on the sequences before reading them in, except that your original file remains intact. Be careful when using equate, because the replacement is case sensitive (i.e., equate</del>=<del class="diffchange diffchange-inline">"t=c g=a" would have had no effect if all the nucleotides are represented by upper case letters!).</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    * PAUP* recognizes all the standard ambiguity codes (e.g., R for purine, Y for pyrimidine, N for undetermined, etc.).</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>tree one = [&U] (1,2,(3,(4,5));</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">  </ins>tree two = [&U] (1,3,(5,(2,4));</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">Trees block</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins>end;</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>A <del class="diffchange diffchange-inline">Trees </del>block has the following structure:</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>#nexus</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>...</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>begin trees;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>translate</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>1 Ephedra,</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>2 Gnetum,</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>3 Welwitschia,</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>4 Ginkgo,</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>5 Pinus</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>tree one = [&U] (1,2,(3,(4,5));</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">  </del>tree two = [&U] (1,3,(5,(2,4));</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>end;</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Some things to note in this example are:</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Some things to note in this example are:</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The translate command provides short alternatives to the taxon names, making the tree descriptions shorter (takes up fewer bytes of disk space).</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>* The translate command provides short alternatives to the taxon names, making the tree descriptions shorter (takes up fewer bytes of disk space).</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* the translate command is not necessary however; it is ok to use the taxon names directly in the tree descriptions</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>* the translate command is not necessary however; it is ok to use the taxon names directly in the tree descriptions</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* the tree command denotes the start of a tree description, which consists of a tree name (e.g., one and two are used here), followed by an equals sign and then the tree topology in the standard, parenthetical notation (often referred to as the Newick or New Hampshire format).</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>* the tree command denotes the start of a tree description, which consists of a tree name (e.g., one and two are used here), followed by an equals sign and then the tree topology in the standard, parenthetical notation (often referred to as the Newick or New Hampshire format).</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The special comments consisting of an ampersand symbol followed by the letter U tell PAUP* to interpret the tree as being an unrooted tree.</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>* The special comments consisting of an ampersand symbol followed by the letter U tell PAUP* to interpret the tree as being an unrooted tree.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* Files containing only the #nexus plus a trees block are called tree files</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">    </del>* Files containing only the #nexus plus a trees block are called tree files</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>=== Sets block ===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>=== Sets block ===</div></td></tr>
</table>
PaulLewis
http://hydrodictyon.eeb.uconn.edu/eebedia/index.php?title=Phylogenetics:_NEXUS_Format&diff=9845&oldid=prev
PaulLewis: /* Commonly-used Nexus blocks */
2009-01-21T22:10:36Z
<p><span dir="auto"><span class="autocomment">Commonly-used Nexus blocks</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 22:10, 21 January 2009</td>
</tr><tr><td colspan="2" class="diff-lineno" id="L34" >Line 34:</td>
<td colspan="2" class="diff-lineno">Line 34:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>=== Commonly-used Nexus blocks ===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>=== Commonly-used Nexus blocks ===</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Here is a list of common Nexus blocks and the most-common commands within these blocks. For a complete description of the Nexus file format, take a look at this paper:</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Here is a list of common Nexus blocks and the most-common commands within these blocks. For a complete description of the Nexus file format, take a look at this paper:</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><div style="background-color: #aaeeee;">Maddison, David R., Swofford, David L. and Maddison, Wayne P. 1997. NEXUS: an extensible file format for systematic information. Systematic Biology 46: 590-621</div></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><div style="background-color: #aaeeee<ins class="diffchange diffchange-inline">; padding: 5px</ins>;">Maddison, David R., Swofford, David L. and Maddison, Wayne P. 1997. NEXUS: an extensible file format for systematic information. Systematic Biology 46: 590-621</div></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==== Taxa block ====</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==== Taxa block ====</div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="L113" >Line 113:</td>
<td colspan="2" class="diff-lineno">Line 114:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>     * the tree command denotes the start of a tree description, which consists of a tree name (e.g., one and two are used here), followed by an equals sign and then the tree topology in the standard, parenthetical notation (often referred to as the Newick or New Hampshire format).</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>     * the tree command denotes the start of a tree description, which consists of a tree name (e.g., one and two are used here), followed by an equals sign and then the tree topology in the standard, parenthetical notation (often referred to as the Newick or New Hampshire format).</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>     * The special comments consisting of an ampersand symbol followed by the letter U tell PAUP* to interpret the tree as being an unrooted tree.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>     * The special comments consisting of an ampersand symbol followed by the letter U tell PAUP* to interpret the tree as being an unrooted tree.</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>     * Files containing only the #nexus plus a trees block are called tree files  </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>     * Files containing only the #nexus plus a trees block are called tree files</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>=== Sets block ===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>=== Sets block ===</div></td></tr>
</table>
PaulLewis